View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10954A_low_734 (Length: 205)
Name: NF10954A_low_734
Description: NF10954A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10954A_low_734 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 168; Significance: 3e-90; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 18 - 189
Target Start/End: Original strand, 21522421 - 21522592
Alignment:
| Q |
18 |
atcattgtaggtgccatttttagaaaagaggggagaggtgtattcagatggaatgggagacaggagaggggaaagatacaaactcataaatctccacttg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
21522421 |
atcattgtaggtgccatttttagaaaagaggggagaggtgtattcagatggaatgggagacaggagaggagaaagatacaaactcataaatctccacttg |
21522520 |
T |
|
| Q |
118 |
catgatacaaattgacagtaaggaacccctgtgcagtgtcgtttagacttcaagaaaagttgtaagtatatt |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21522521 |
catgatacaaattgacagtaaggaacccctgtgcagtgtcgtttagacttcaagaaaagttgtaagtatatt |
21522592 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 89 - 181
Target Start/End: Original strand, 19733053 - 19733145
Alignment:
| Q |
89 |
aaagatacaaactcataaatctccacttgcatgatacaaattgacagtaaggaacccctgtgcagtgtcgtttagacttcaagaaaagttgta |
181 |
Q |
| |
|
||||||||||||| |||||| || |||||||||||| ||||||| ||||||| |||| |||||| ||||||||| |||||||||||||||||| |
|
|
| T |
19733053 |
aaagatacaaactaataaatatcaacttgcatgatataaattgaaagtaaggcacccttgtgcaatgtcgtttaaacttcaagaaaagttgta |
19733145 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University