View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10954A_low_737 (Length: 203)
Name: NF10954A_low_737
Description: NF10954A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10954A_low_737 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 156; Significance: 4e-83; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 21 - 188
Target Start/End: Complemental strand, 32062663 - 32062496
Alignment:
| Q |
21 |
atctattggcttacctccttgtttctgtttgaggtcatcatcatcatcggcaaggattgaaaacccaccgaattcctttccactattgttctccagtgca |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
32062663 |
atctattggcttacctccttgtttctgtttgaggtcatcatcatcatcggcaaggattgaaaacccaccgaattcctttccactattgttctccggtgca |
32062564 |
T |
|
| Q |
121 |
ttctcttgcttcaatgaccttttctttctaacaaagtctattggcttcccaaacatgttgttgatgtc |
188 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
32062563 |
ttctcttgcttcagtgaccttttctttctaacaaagtctattggcttcccaaacatgttgtttatgtc |
32062496 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 61 - 167
Target Start/End: Complemental strand, 32062758 - 32062652
Alignment:
| Q |
61 |
tcatcatcggcaaggattgaaaacccaccgaattcctttccactattgttctccagtgcattctcttgcttcaatgaccttttctttctaacaaagtcta |
160 |
Q |
| |
|
|||||||| ||||| || |||||||||| || |||||||||||| |||||| || |||| ||||| ||||||| | | ||||| || | |||||| |||| |
|
|
| T |
32062758 |
tcatcatccgcaagtatcgaaaacccactgagttcctttccactgttgttccccggtgctttctcctgcttcattaatctttttttccgaacaaaatcta |
32062659 |
T |
|
| Q |
161 |
ttggctt |
167 |
Q |
| |
|
||||||| |
|
|
| T |
32062658 |
ttggctt |
32062652 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University