View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10954A_low_742 (Length: 202)
Name: NF10954A_low_742
Description: NF10954A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10954A_low_742 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 68; Significance: 1e-30; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 68; E-Value: 1e-30
Query Start/End: Original strand, 46 - 146
Target Start/End: Complemental strand, 9867765 - 9867665
Alignment:
| Q |
46 |
atgttgaagtcttcaaccctttgattactgttgattnnnnnnnttgccgcgagaaactctgaaacttggcatgtcgtcgatcatcctcccatgacccata |
145 |
Q |
| |
|
||||||||||||||||||||||||| ||| |||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
9867765 |
atgttgaagtcttcaaccctttgatgactattgattctcccccttgccgcgagaaactctgaaacttggcatgtcctcgatcatcctcccatgacccata |
9867666 |
T |
|
| Q |
146 |
t |
146 |
Q |
| |
|
| |
|
|
| T |
9867665 |
t |
9867665 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 3 - 49
Target Start/End: Complemental strand, 9867867 - 9867821
Alignment:
| Q |
3 |
gatcgctactaaaggcaaaccacaatcgactagtcttttgcgaatgt |
49 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
9867867 |
gatcgctactaaaggcaaaccacagtcgactagtcttttgcgaatgt |
9867821 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University