View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10954A_low_745 (Length: 201)
Name: NF10954A_low_745
Description: NF10954A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10954A_low_745 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 132; Significance: 9e-69; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 132; E-Value: 9e-69
Query Start/End: Original strand, 23 - 178
Target Start/End: Original strand, 11027625 - 11027780
Alignment:
| Q |
23 |
aacaatatcttgttaacctacaaatctcaggttttgtgccttctcatcagatggaaaaggaaaaaatgaaagagtcgtgtcagtaaaacacaaactccca |
122 |
Q |
| |
|
||||| ||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11027625 |
aacaaaatcttgttaacctccaaatctcaggttctgtgccttctcatcagatggaaaaggaaaaaatgaaagagtcgtgtcagtaaaacacaaactccca |
11027724 |
T |
|
| Q |
123 |
taaaactctctcagtagatcaagtctttcatgaagtggagtatattgattagaaat |
178 |
Q |
| |
|
||||||||||||||||||||||||| ||||| ||||||| |||||||||||||||| |
|
|
| T |
11027725 |
taaaactctctcagtagatcaagtcattcattaagtggaatatattgattagaaat |
11027780 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 83 - 144
Target Start/End: Original strand, 11042566 - 11042627
Alignment:
| Q |
83 |
aaaaaatgaaagagtcgtgtcagtaaaacacaaactcccataaaactctctcagtagatcaa |
144 |
Q |
| |
|
||||||||||| |||| ||| ||||||||| |||| ||||||||||||| |||||||||||| |
|
|
| T |
11042566 |
aaaaaatgaaatagtcatgttagtaaaacagaaacacccataaaactctgtcagtagatcaa |
11042627 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University