View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10954A_low_748 (Length: 201)
Name: NF10954A_low_748
Description: NF10954A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10954A_low_748 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 161; Significance: 4e-86; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 161; E-Value: 4e-86
Query Start/End: Original strand, 14 - 198
Target Start/End: Original strand, 35617739 - 35617923
Alignment:
| Q |
14 |
aagaatatggatgcatgtaagaaaaatgatgaaagtgctactgtgaaatcaacagcaacaaaaacagtcaagtttccagtttatgatactgggatattgg |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||| |||||||||||| ||| |
|
|
| T |
35617739 |
aagaatatggatgcatgtaagaaaaatgatgaaagtgctactgtgaaatcaacagcaacaaaagcagtcaagtttccggtttgcgatactgggataatgg |
35617838 |
T |
|
| Q |
114 |
aggaggaagtaacagccgaaggcgaatataaagtgcaggagaagagtattgtgcaggaagatcttaaacatggtactagtactac |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
35617839 |
aggaggaagtaacagccgaaggcgaatataaagtgcaggagaagagtattgtgaaggaagatcttaaacatggtactagtactac |
35617923 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University