View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10955_high_19 (Length: 331)
Name: NF10955_high_19
Description: NF10955
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10955_high_19 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 21 - 325
Target Start/End: Original strand, 10051125 - 10051430
Alignment:
| Q |
21 |
acatcacactaatatgttttaatatttaacttaaatggcagcggtatttgattacaagtcttggattgggaaggataatgactggcaacccaaggccatg |
120 |
Q |
| |
|
||||||||||||||||||||||| ||||| |||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10051125 |
acatcacactaatatgttttaatttttaaattaaattgcagcggtatttgattacaagtcatggattgggaaggataatgactggcaacccaaggccatg |
10051224 |
T |
 |
| Q |
121 |
atagcttttcatgcagtagctgtgaacactaatttacaagaaaatgaaggttagaaacgttagcagctttcatgtccctgactcaattactgaagtaaat |
220 |
Q |
| |
|
|| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10051225 |
attgcttttcatgctgtagctgtgaacactaatttacaagaaaatgaaggttagaaacgttaacagctttcatgtccctgactcaattactgaagtaaat |
10051324 |
T |
 |
| Q |
221 |
atcagaaaacctg-tataagaataagtacaaatctgatgacagcaagacgctgcatattaagcagttaccaaaacaaacaaatcagtaaaatcagcccta |
319 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||| | |||||||||||| |||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
10051325 |
atcagaaaacctgctataagaataagtacaaatctgatgacagcaacatgctgcatattaaccagttaccaacacaaacaaatcagtaaaatcagcccta |
10051424 |
T |
 |
| Q |
320 |
tgctac |
325 |
Q |
| |
|
|||||| |
|
|
| T |
10051425 |
tgctac |
10051430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University