View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10955_high_22 (Length: 274)
Name: NF10955_high_22
Description: NF10955
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10955_high_22 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 126; Significance: 5e-65; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 126; E-Value: 5e-65
Query Start/End: Original strand, 19 - 160
Target Start/End: Complemental strand, 6096788 - 6096648
Alignment:
| Q |
19 |
tactgattgtttgtttatagtagatgcttttaattcgaacaattcttcatttgagacataaccaaatggtgagatgggattatcgacttttgatttcaac |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||| |
|
|
| T |
6096788 |
tactgattgtttgtttatagtagatgcttt-aattcgaacaattcttcatttgagacataaccagatggtgagataggattatcgacttttgatttcaac |
6096690 |
T |
 |
| Q |
119 |
aaaaatggtccgtttactatgatttttcgtggcagcaacctt |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6096689 |
aaaaatggtccgtttactatgatttttcgtggcagcaacctt |
6096648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 159 - 214
Target Start/End: Complemental strand, 6096609 - 6096554
Alignment:
| Q |
159 |
ttaatgtgatttttagtcaacaatatttaaatggcatccatgcctttcgttactac |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
6096609 |
ttaatgtgatttttagtcaacaatatttaaatggcatccatgcttttcgttactac |
6096554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 224 - 261
Target Start/End: Complemental strand, 6096530 - 6096493
Alignment:
| Q |
224 |
ataacaaattccacattggaagtagatttgattcccct |
261 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
6096530 |
ataaaaaattccacattggaagtagatttgattcccct |
6096493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University