View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10955_high_9 (Length: 405)
Name: NF10955_high_9
Description: NF10955
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10955_high_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 157; Significance: 2e-83; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 70 - 255
Target Start/End: Complemental strand, 43441203 - 43441018
Alignment:
| Q |
70 |
catatatcatccatgtctttatgcttctctatttaatgagctagattttcattgtnnnnnnnctactacgatatgaacatgtcggaaattcatacttgca |
169 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43441203 |
catatatcatccatgtctttatgcttctctatttaatgagctagattttcattgtaaaaaaactactacgatatgaacatgtcggaaattcatacttgca |
43441104 |
T |
|
| Q |
170 |
accattattggcctaattaagcgcactaaaaatttactaagcaaagatttaataaaattctaggtggaataattattgatccgatt |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
43441103 |
accattattggcctaattaagcgcactaaaaatttaccaagcaaagatttaataaaattctaggtggaataattattgatctgatt |
43441018 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 119; E-Value: 1e-60
Query Start/End: Original strand, 240 - 366
Target Start/End: Complemental strand, 43440618 - 43440492
Alignment:
| Q |
240 |
aattattgatccgattgcattcatctcacaatcaaactttgaattcttgactagattatacttatcttgaggtttaattcctaatgaacattgtcatctt |
339 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
43440618 |
aattattgatctgattgcattcatctcacaatcaaactttgaattcttgactagattatacttatcttgaggtttaattcctaatgaacatagtcatctt |
43440519 |
T |
|
| Q |
340 |
ttcttagaaactagaaggctaccataa |
366 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
43440518 |
ttcttagaaactagaaggctaccataa |
43440492 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University