View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10955_low_10 (Length: 396)
Name: NF10955_low_10
Description: NF10955
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10955_low_10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 333; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 333; E-Value: 0
Query Start/End: Original strand, 1 - 380
Target Start/End: Original strand, 38359797 - 38360177
Alignment:
| Q |
1 |
ccccctccaagcctcttcttgtttggaggattcttctcaacaagctccccacatatgacattcttgcgaaaagaggttgtttgcttccctctatttgttc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
38359797 |
ccccctccaagcctcttcttgtttggaggattcttctcaacaagctccccacagatgacattcttgcgaaaagaggttgtttgcttccctctattttttc |
38359896 |
T |
|
| Q |
101 |
tctttgtggaaaaatcaagaaactcaatctcacatgttccttgaatgcactttctcttatgacatttgg-cctggttgtttcacattctcaaaatcacct |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
38359897 |
tctttgtggaaaaatcaagaaactcaatctcacatgttccgtgaatgcactttctcttatgacatttggtcctggttgtttcacattctcaaaatcacct |
38359996 |
T |
|
| Q |
200 |
gaaacttttcatgttttttggacatcataaggatagctgaaagaaattggtccccgcattgtagattggttgctctatctgccataattcacttcttcaa |
299 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||| |||||||||||||||| || |||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
38359997 |
gaaacttttcaagttttttggacatcataaggatagctaaaagaaattggtccccacaatgtagactggttgctctatctgccataattcactgcttcaa |
38360096 |
T |
|
| Q |
300 |
caccaactggttttgcataaaccaaagaagatttaatgctaagataatcaatgtcagatatgttgtcaacatggttatctc |
380 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38360097 |
caccatctggttttgcataaaccaaagaagatttaatgctaagataatcaatgtcagatatgttgtcaacatggttatctc |
38360177 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University