View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10955_low_20 (Length: 311)

Name: NF10955_low_20
Description: NF10955
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10955_low_20
NF10955_low_20
[»] chr5 (3 HSPs)
chr5 (251-306)||(42430768-42430823)
chr5 (1-33)||(42431038-42431070)
chr5 (268-306)||(42430814-42430852)


Alignment Details
Target: chr5 (Bit Score: 48; Significance: 2e-18; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 251 - 306
Target Start/End: Complemental strand, 42430823 - 42430768
Alignment:
251 gtgtgctgcttcaatcatttcttcttccaaatctatgaatctatttctgtgctgct 306  Q
    ||||||||||||||||||||||||||| |||||||||||||||||| |||||||||    
42430823 gtgtgctgcttcaatcatttcttcttctaaatctatgaatctatttgtgtgctgct 42430768  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 33
Target Start/End: Complemental strand, 42431070 - 42431038
Alignment:
1 tcacttaggtgttacttcaattattaacggaat 33  Q
    |||||||||||||||||||||||||||||||||    
42431070 tcacttaggtgttacttcaattattaacggaat 42431038  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 268 - 306
Target Start/End: Complemental strand, 42430852 - 42430814
Alignment:
268 tttcttcttccaaatctatgaatctatttctgtgctgct 306  Q
    |||||||||| |||||||||||||||||| |||||||||    
42430852 tttcttcttctaaatctatgaatctatttgtgtgctgct 42430814  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University