View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10955_low_20 (Length: 311)
Name: NF10955_low_20
Description: NF10955
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10955_low_20 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 48; Significance: 2e-18; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 251 - 306
Target Start/End: Complemental strand, 42430823 - 42430768
Alignment:
| Q |
251 |
gtgtgctgcttcaatcatttcttcttccaaatctatgaatctatttctgtgctgct |
306 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||| ||||||||| |
|
|
| T |
42430823 |
gtgtgctgcttcaatcatttcttcttctaaatctatgaatctatttgtgtgctgct |
42430768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 33
Target Start/End: Complemental strand, 42431070 - 42431038
Alignment:
| Q |
1 |
tcacttaggtgttacttcaattattaacggaat |
33 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
42431070 |
tcacttaggtgttacttcaattattaacggaat |
42431038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 268 - 306
Target Start/End: Complemental strand, 42430852 - 42430814
Alignment:
| Q |
268 |
tttcttcttccaaatctatgaatctatttctgtgctgct |
306 |
Q |
| |
|
|||||||||| |||||||||||||||||| ||||||||| |
|
|
| T |
42430852 |
tttcttcttctaaatctatgaatctatttgtgtgctgct |
42430814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University