View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10955_low_24 (Length: 264)

Name: NF10955_low_24
Description: NF10955
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10955_low_24
NF10955_low_24
[»] chr1 (3 HSPs)
chr1 (52-147)||(51060084-51060179)
chr1 (190-253)||(51059980-51060043)
chr1 (17-57)||(51060205-51060245)


Alignment Details
Target: chr1 (Bit Score: 84; Significance: 5e-40; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 52 - 147
Target Start/End: Complemental strand, 51060179 - 51060084
Alignment:
52 aatgtgatcatatttatggtttgaatgggaatttgatggaatggtttatggtctctctttaatatctcattgttcttctaattctctaatttgaag 147  Q
    ||||||||||||||||||||||||||||||||||||| ||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||    
51060179 aatgtgatcatatttatggtttgaatgggaatttgatagaatgctttatgatctctctttaatatctcattgttcttctaattctctaatttgaag 51060084  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 190 - 253
Target Start/End: Complemental strand, 51060043 - 51059980
Alignment:
190 taaatatttccaaatggacgtacggactatcatttatttcatttcccttcctcattcttttctt 253  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51060043 taaatatttccaaatggacgtacggactatcatttatttcatttcccttcctcattcttttctt 51059980  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 17 - 57
Target Start/End: Complemental strand, 51060245 - 51060205
Alignment:
17 cacacttgccactaaatctttgaagaggtttatggaatgtg 57  Q
    |||||||||||||||||||||||||||||||||||||||||    
51060245 cacacttgccactaaatctttgaagaggtttatggaatgtg 51060205  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University