View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10955_low_24 (Length: 264)
Name: NF10955_low_24
Description: NF10955
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10955_low_24 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 84; Significance: 5e-40; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 52 - 147
Target Start/End: Complemental strand, 51060179 - 51060084
Alignment:
| Q |
52 |
aatgtgatcatatttatggtttgaatgggaatttgatggaatggtttatggtctctctttaatatctcattgttcttctaattctctaatttgaag |
147 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51060179 |
aatgtgatcatatttatggtttgaatgggaatttgatagaatgctttatgatctctctttaatatctcattgttcttctaattctctaatttgaag |
51060084 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 190 - 253
Target Start/End: Complemental strand, 51060043 - 51059980
Alignment:
| Q |
190 |
taaatatttccaaatggacgtacggactatcatttatttcatttcccttcctcattcttttctt |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51060043 |
taaatatttccaaatggacgtacggactatcatttatttcatttcccttcctcattcttttctt |
51059980 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 17 - 57
Target Start/End: Complemental strand, 51060245 - 51060205
Alignment:
| Q |
17 |
cacacttgccactaaatctttgaagaggtttatggaatgtg |
57 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51060245 |
cacacttgccactaaatctttgaagaggtttatggaatgtg |
51060205 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University