View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10955_low_28 (Length: 211)
Name: NF10955_low_28
Description: NF10955
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10955_low_28 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 122; Significance: 9e-63; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 122; E-Value: 9e-63
Query Start/End: Original strand, 10 - 195
Target Start/End: Complemental strand, 5570104 - 5569913
Alignment:
| Q |
10 |
agaagcagagaaccacccaccaatatctctaatttaggtcatttctctttttccttc-------nnnnnnnatatgtataaatggtagaaatttaacatt |
102 |
Q |
| |
|
|||| |||| ||||| || |||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
5570104 |
agaaccagacaaccagcccccaatatctctaatttaggtcatttctc-ttttccttcttttttttttttttatatgtataaatggtagaaatttaacatt |
5570006 |
T |
|
| Q |
103 |
ttggggactgcggttatcattttgtgaaatatgtttattgtgtcatcatatgttatgaaaatgttcattttgttgatgagcgtttgcagtttg |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5570005 |
ttggggactgcggttatcattttgtgaaatatgtttattgtgtcatcatatgttatgaaaatgttcattttgttgatgagcgtttgcagtttg |
5569913 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 123 - 182
Target Start/End: Complemental strand, 2498188 - 2498129
Alignment:
| Q |
123 |
tttgtgaaatatgtttattgtgtcatcatatgttatgaaaatgttcattttgttgatgag |
182 |
Q |
| |
|
||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2498188 |
tttgtaaaatatgtttattatgtcatcatatgttatgaaaatgttcattttgttgatgag |
2498129 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 52; Significance: 5e-21; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 123 - 182
Target Start/End: Complemental strand, 27100776 - 27100717
Alignment:
| Q |
123 |
tttgtgaaatatgtttattgtgtcatcatatgttatgaaaatgttcattttgttgatgag |
182 |
Q |
| |
|
||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27100776 |
tttgtaaaatatgtttattatgtcatcatatgttatgaaaatgttcattttgttgatgag |
27100717 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University