View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10956_high_24 (Length: 234)

Name: NF10956_high_24
Description: NF10956
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10956_high_24
NF10956_high_24
[»] chr2 (2 HSPs)
chr2 (3-217)||(7156745-7156959)
chr2 (157-217)||(11236973-11237033)


Alignment Details
Target: chr2 (Bit Score: 154; Significance: 8e-82; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 3 - 217
Target Start/End: Original strand, 7156745 - 7156959
Alignment:
3 caagaagcatctaggatagttttatcattgagagggtaatctaggtgcaaggcggtggggatggaggttacttttgtgannnnnnnnnnnnnnnggtaag 102  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||               ||||||    
7156745 caagaagcaactaggatagttttatcattgagagggtaatctaggtgcaaggcagtggggatggaggttacttttgtgaagagagaggagagagggtaag 7156844  T
103 acatgtggtcgacctcgagtgagaaatgggtgaaacttgagacgaggagacgtgggcgcgtggttgacacatgaaggtgctttttggcgaatttgtgatc 202  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7156845 acatgtggtcgacctcgagtgagaaatgggtgaaacttgagacgaggagacgtgggcgcgtggttgacacatgaaggtgctttttggcgaatttgtgatc 7156944  T
203 ggagatgagatattt 217  Q
    | |||||||| ||||    
7156945 gaagatgagagattt 7156959  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 217
Target Start/End: Complemental strand, 11237033 - 11236973
Alignment:
157 ggcgcgtggttgacacatgaaggtgctttttggcgaatttgtgatcggagatgagatattt 217  Q
    |||||||||| ||||| |||||||| ||||||  ||||||| |||||||||||||| ||||    
11237033 ggcgcgtggtggacacgtgaaggtgttttttgatgaatttgggatcggagatgagagattt 11236973  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University