View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10956_high_24 (Length: 234)
Name: NF10956_high_24
Description: NF10956
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10956_high_24 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 154; Significance: 8e-82; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 3 - 217
Target Start/End: Original strand, 7156745 - 7156959
Alignment:
| Q |
3 |
caagaagcatctaggatagttttatcattgagagggtaatctaggtgcaaggcggtggggatggaggttacttttgtgannnnnnnnnnnnnnnggtaag |
102 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||| |
|
|
| T |
7156745 |
caagaagcaactaggatagttttatcattgagagggtaatctaggtgcaaggcagtggggatggaggttacttttgtgaagagagaggagagagggtaag |
7156844 |
T |
|
| Q |
103 |
acatgtggtcgacctcgagtgagaaatgggtgaaacttgagacgaggagacgtgggcgcgtggttgacacatgaaggtgctttttggcgaatttgtgatc |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7156845 |
acatgtggtcgacctcgagtgagaaatgggtgaaacttgagacgaggagacgtgggcgcgtggttgacacatgaaggtgctttttggcgaatttgtgatc |
7156944 |
T |
|
| Q |
203 |
ggagatgagatattt |
217 |
Q |
| |
|
| |||||||| |||| |
|
|
| T |
7156945 |
gaagatgagagattt |
7156959 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 217
Target Start/End: Complemental strand, 11237033 - 11236973
Alignment:
| Q |
157 |
ggcgcgtggttgacacatgaaggtgctttttggcgaatttgtgatcggagatgagatattt |
217 |
Q |
| |
|
|||||||||| ||||| |||||||| |||||| ||||||| |||||||||||||| |||| |
|
|
| T |
11237033 |
ggcgcgtggtggacacgtgaaggtgttttttgatgaatttgggatcggagatgagagattt |
11236973 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University