View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10956_high_5 (Length: 471)
Name: NF10956_high_5
Description: NF10956
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10956_high_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 402; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 402; E-Value: 0
Query Start/End: Original strand, 34 - 455
Target Start/End: Original strand, 30968591 - 30969012
Alignment:
| Q |
34 |
cagagaggtagttggatgtttaggagaacgttggtatgtgaactctttcaaaaaatgtgtcagatcattgtttgttggttcttaggtctagatcaattga |
133 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30968591 |
cagagaggtagttggatgtttaggagaacgttggtatgtgaactcttttaaaaaatgtgtcagatcattgtttgttggttcttaggtctagatcaattga |
30968690 |
T |
 |
| Q |
134 |
ccgagactgaaaccaatatgatttaataactattggtcgtaagaaaacaactttatgatcttgtgctccattcttgattgtctataacattgtaaggttg |
233 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30968691 |
ccgagaccgaaaccaatatgatttaataactattggtcgtaagaaaacaactttatgatcttgtgctccattcttgattgtctataacattgtaaggttg |
30968790 |
T |
 |
| Q |
234 |
gcggggaaatgttgtaattgataaattgaagggggtgaagttgattataaaaaattgaatcgcaccgtgaggtcttatactctcttaagcatcaaagtgc |
333 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
30968791 |
gtggggaaatgttgtaattgataaattgaagggggtgaagttgattataaaaaattgaatcgcaccgtgaggtcttatactctcttaagcattgaagtgc |
30968890 |
T |
 |
| Q |
334 |
ttgcaagcaccctcccttccctcatttcacatctcagcaggttgctgctcgatagaggctgagctttctgatcactctagatcaacaaggttgatgtagg |
433 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30968891 |
ttgcaagcaccctcccttccctcatttcacatctcagcaggttgctgctcgatagaggctgagctttctgatcactctagatcaacaaggttgatgtagg |
30968990 |
T |
 |
| Q |
434 |
ctacactataaactcttgttag |
455 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
30968991 |
ctacactataaactcttgttag |
30969012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University