View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10956_low_11 (Length: 350)
Name: NF10956_low_11
Description: NF10956
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10956_low_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 8 - 333
Target Start/End: Original strand, 54658063 - 54658410
Alignment:
| Q |
8 |
acctacctgttagttgtcgttgctggccagtgacatagtgccacgagctattacgtgattgtcacagatttaaaaaccgatcatccactgtttgttttaa |
107 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
54658063 |
acctacctgttagttgtcgttgctagccagtgacatagtgccacgagctattacgtgattgtcacaaatttaaaaaccgatcatccactgtttgttttaa |
54658162 |
T |
 |
| Q |
108 |
atctaattgctggtttgcagttgcagcgagccccacaggcaggctccaccatcgtttacgtcatgtc-atgtctcactcaaacctcctacctcaaacaaa |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
54658163 |
atctaattgctggtttgcagttgcagcgagccccacagccaggctccaccatcgtttacgtcatgtcaatgtctcactcaaacctcctacctcaaacaaa |
54658262 |
T |
 |
| Q |
207 |
ataacattattc---cttccatct-----atctatccattctagcagcattcatatact----aaccagtattattatattatcaatcact------cac |
288 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||| ||| |
|
|
| T |
54658263 |
ataacattattcattattccatctatctaatctatccattctagcagtattcatatactaaccaaccagtattattatattatcaatcactcacacacac |
54658362 |
T |
 |
| Q |
289 |
acacactgtcacac---ataattaacaaaacaaaataggtttgtcttc |
333 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
54658363 |
acacactgtcacacataataattaacaaaacaaaataggtttgtcttc |
54658410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University