View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10957_high_27 (Length: 369)
Name: NF10957_high_27
Description: NF10957
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10957_high_27 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 330; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 330; E-Value: 0
Query Start/End: Original strand, 18 - 363
Target Start/End: Original strand, 34669508 - 34669853
Alignment:
| Q |
18 |
gtacctgtttcaagcaatggaaattggtcttcttttgaggccccttttgtggctaacaacaatgttgtacacaatccctattttgaatatccttatggag |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
34669508 |
gtacctgtttcaagcaatggaaattggtcttcttttgaggccccttttgtggctaacaacaatgttgtacataatccctattttgaatatccttatggag |
34669607 |
T |
 |
| Q |
118 |
gaaatagctttggaagtataggtgctttgcaaaacgaggaaacaaatttattgaactgtgttgttgctggtcctaatgtttggcaaccttcacaacccaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34669608 |
gaaatagctttggaagtataggtgctttgcaaaacgaggaaacaaatttattgaactgtgttgttgctggtcctaatgtttggcaaccttcacaacccaa |
34669707 |
T |
 |
| Q |
218 |
ttatttgcaaagtcttgcaagtagttctgggactaaagtgactgtggatcataatattattaccaatcaacatatgggaatgcaaggagaaggtcagcag |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34669708 |
ttatttgcaaagtcttgcaagtagttctgggactaaagtgactgtggatcataatattattaccaatcaacatatgggaatgcaaggagaaggtcagcag |
34669807 |
T |
 |
| Q |
318 |
cattctaactattattcttttggacactgtaaggaattcttctcac |
363 |
Q |
| |
|
|||||||| ||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
34669808 |
cattctaagtattattcttttggaaactgtaaggaattcttttcac |
34669853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University