View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10957_high_32 (Length: 352)
Name: NF10957_high_32
Description: NF10957
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10957_high_32 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 86 - 350
Target Start/End: Complemental strand, 32777189 - 32776926
Alignment:
| Q |
86 |
ctgtctaaattatcaaaatatcttcttgcaatttgaatatacaaatggattaaaacatttttctggataggnnnnnnnncgtgtgtggcttctattgatc |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
32777189 |
ctgtctaaattatcaaaatatcttcttgcaatttgaatatacaaatggattaaaacatttt-ctggataggttttttttcgtgtgtggcttctattgatc |
32777091 |
T |
|
| Q |
186 |
attggttctgcaatccatgtgccatctgtcaaatttatggatgccagaatgtccctcccttattccccaccacactccattccatttccaatcttctcat |
285 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
32777090 |
attggttctgcaatccatgtgccatctgtcaaatttatgggtgccagaatgtccctcccttattccccaccacactccattctatttccaatcttctcat |
32776991 |
T |
|
| Q |
286 |
caaaaagcttgcaacaaatgcactttatcctaccaacttaaatgctgtttttctctgctcctcct |
350 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
32776990 |
caaaaagcttgcaacaaatgcactttatcctaccaacttaaatgctgtttttctctgctcgtcct |
32776926 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University