View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10957_high_42 (Length: 299)
Name: NF10957_high_42
Description: NF10957
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10957_high_42 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 210; Significance: 1e-115; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 214
Target Start/End: Original strand, 11517183 - 11517396
Alignment:
| Q |
1 |
agagtggcttccacgacagcagtcgatgaaaagcatctcgctaaaatcgcagatgcattcaaagagctagcaaatgccatcgtcaacgaaaatatgatcg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11517183 |
agagtggcttccacgacagcagtcgatgaaaagcatctcgctaaaatcgcagatgcattcaaagagctagcaaatgccatcgtcaacgaaaatatgatcg |
11517282 |
T |
|
| Q |
101 |
aggttgctgctttttcccgtgcatgttcttttgtagctcccctttttggtagtgttggctttcatttccaattcattgagatggattacgttaccaaggt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
11517283 |
aggttgctgctttttcccgtgcatgttcttttgtagctcccctttttggtagtgttggctttcatttccagttcattgagatggattacgttaccaaggt |
11517382 |
T |
|
| Q |
201 |
aagctaccagtaaa |
214 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
11517383 |
aagctaccagtaaa |
11517396 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 252 - 284
Target Start/End: Original strand, 11517425 - 11517457
Alignment:
| Q |
252 |
gtaacatgtatgtgaatatgtgatcttatttgt |
284 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |
|
|
| T |
11517425 |
gtaacatgtatgtgaatatgggatcttatttgt |
11517457 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University