View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10957_high_51 (Length: 271)

Name: NF10957_high_51
Description: NF10957
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10957_high_51
NF10957_high_51
[»] chr4 (2 HSPs)
chr4 (10-185)||(8112002-8112179)
chr4 (197-248)||(8114068-8114119)
[»] chr6 (1 HSPs)
chr6 (10-102)||(1087443-1087536)


Alignment Details
Target: chr4 (Bit Score: 79; Significance: 5e-37; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 10 - 185
Target Start/End: Complemental strand, 8112179 - 8112002
Alignment:
10 cgttggacagttgtagcgtttctttctctctct--taggtactcattcgtgtgagaaatggataaatcatatattttttggtgtgtaatatctcagttgt 107  Q
    |||||||  |||||||| |||||||||||||||  |||| ||||| |||||||||||| ||||||||||| |||||||| | |||||||||||||||| |    
8112179 cgttggattgttgtagcttttctttctctctctcttaggcactcaatcgtgtgagaaagggataaatcatgtattttttagggtgtaatatctcagtttt 8112080  T
108 tggataggtgcaacagagaaagatgcagacatacagacggttgaggaaccagatctgaaatttgctgactcttggttt 185  Q
    |||||||| ||||||  ||| |||||||| |||| ||| |||||||| ||||||||| || ||| ||| |||||||||    
8112079 tggataggggcaacaatgaaggatgcagatatacggactgttgaggatccagatctgcaacttgttgattcttggttt 8112002  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 197 - 248
Target Start/End: Original strand, 8114068 - 8114119
Alignment:
197 ccttaatttctttctctctcatctgagctcttatgcaagcccatggttgact 248  Q
    ||||||||||  ||||||| ||||||||||||||||||||| ||||||||||    
8114068 ccttaatttccctctctcttatctgagctcttatgcaagccaatggttgact 8114119  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 66; Significance: 3e-29; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 10 - 102
Target Start/End: Original strand, 1087443 - 1087536
Alignment:
10 cgttggaca-gttgtagcgtttctttctctctcttaggtactcattcgtgtgagaaatggataaatcatatattttttggtgtgtaatatctca 102  Q
    ||||||||| |||| ||| ||||||||||||||||||| ||||| |||||||||||| ||||||||||||||||||||||||||||||||||||    
1087443 cgttggacatgttgcagcttttctttctctctcttaggcactcaatcgtgtgagaaagggataaatcatatattttttggtgtgtaatatctca 1087536  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University