View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10957_high_51 (Length: 271)
Name: NF10957_high_51
Description: NF10957
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10957_high_51 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 79; Significance: 5e-37; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 10 - 185
Target Start/End: Complemental strand, 8112179 - 8112002
Alignment:
| Q |
10 |
cgttggacagttgtagcgtttctttctctctct--taggtactcattcgtgtgagaaatggataaatcatatattttttggtgtgtaatatctcagttgt |
107 |
Q |
| |
|
||||||| |||||||| ||||||||||||||| |||| ||||| |||||||||||| ||||||||||| |||||||| | |||||||||||||||| | |
|
|
| T |
8112179 |
cgttggattgttgtagcttttctttctctctctcttaggcactcaatcgtgtgagaaagggataaatcatgtattttttagggtgtaatatctcagtttt |
8112080 |
T |
 |
| Q |
108 |
tggataggtgcaacagagaaagatgcagacatacagacggttgaggaaccagatctgaaatttgctgactcttggttt |
185 |
Q |
| |
|
|||||||| |||||| ||| |||||||| |||| ||| |||||||| ||||||||| || ||| ||| ||||||||| |
|
|
| T |
8112079 |
tggataggggcaacaatgaaggatgcagatatacggactgttgaggatccagatctgcaacttgttgattcttggttt |
8112002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 197 - 248
Target Start/End: Original strand, 8114068 - 8114119
Alignment:
| Q |
197 |
ccttaatttctttctctctcatctgagctcttatgcaagcccatggttgact |
248 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||||||||| |||||||||| |
|
|
| T |
8114068 |
ccttaatttccctctctcttatctgagctcttatgcaagccaatggttgact |
8114119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 66; Significance: 3e-29; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 10 - 102
Target Start/End: Original strand, 1087443 - 1087536
Alignment:
| Q |
10 |
cgttggaca-gttgtagcgtttctttctctctcttaggtactcattcgtgtgagaaatggataaatcatatattttttggtgtgtaatatctca |
102 |
Q |
| |
|
||||||||| |||| ||| ||||||||||||||||||| ||||| |||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
1087443 |
cgttggacatgttgcagcttttctttctctctcttaggcactcaatcgtgtgagaaagggataaatcatatattttttggtgtgtaatatctca |
1087536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University