View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10957_low_13 (Length: 531)
Name: NF10957_low_13
Description: NF10957
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10957_low_13 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 253; Significance: 1e-140; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 253; E-Value: 1e-140
Query Start/End: Original strand, 100 - 356
Target Start/End: Complemental strand, 48187055 - 48186799
Alignment:
| Q |
100 |
aaggtgaaggagggtggtaaaagtaagaaatggaggttatggagaagttcaccaggagataacagttcatggaagggtttcaaaacaaaccaccacaaag |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48187055 |
aaggtgaaggagggtggtaaaagtaagaaatggaggttatggagaagttcaccaggagataacagttcatggaagggtttcaaaacaaaccaccacaaag |
48186956 |
T |
|
| Q |
200 |
cagcttctgaagggtctgaatctccaactgctgctgaagcttacactgctgcagtggctaccgttgttagagctcaacctaaggattttagacttgttag |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48186955 |
cagcttctgaagggtctgaatctccaactgctgctgaagcttacactgctgcagtggctaccgttgttagagctcaacctaaggattttagacttgttag |
48186856 |
T |
|
| Q |
300 |
gcaaaaatgggctgttattagaatccaaaccactttccgcgccttcttggtattcaa |
356 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48186855 |
gcaagaatgggctgttattagaatccaaaccactttccgcgccttcttggtattcaa |
48186799 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 3 - 55
Target Start/End: Complemental strand, 48187159 - 48187107
Alignment:
| Q |
3 |
agatgaacagcatgtaagttacagttactattttcatataacccacaaaaaaa |
55 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48187159 |
agatgaacagcatgtaagttacagttactattttcatataacccacaaaaaaa |
48187107 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 456 - 507
Target Start/End: Complemental strand, 48186692 - 48186641
Alignment:
| Q |
456 |
gtttagattggaaaattttggacattgatctattttagggtttacatgatag |
507 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48186692 |
gtttagattggaaaattttggacattgatctattttagggtttacatgatag |
48186641 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University