View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10957_low_30 (Length: 366)
Name: NF10957_low_30
Description: NF10957
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10957_low_30 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 308; Significance: 1e-173; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 308; E-Value: 1e-173
Query Start/End: Original strand, 1 - 352
Target Start/End: Original strand, 116622 - 116978
Alignment:
| Q |
1 |
tacattgcccatcctgcttgattaatttcttccatttccgagttattctac----acttgtgagctcagagaatgataccatggccatttttcgtgactg |
96 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |||||||||| |||||| ||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
116622 |
tacattgctcatcctgcttgattaatttcttccctttccgagttgttctacgtacacttgtgggctcagagaatgataccatggccatttttcgtgactg |
116721 |
T |
|
| Q |
97 |
ggaaagaatcgatttcgatgcccatctcaagcattctcttatttgctagcttaaacataccctcattattttttaatagattttcaaatgacaatgcaat |
196 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
116722 |
ggaaagaatcgatttcgatgtccatctcaagcattctcttatttgctagcttaaacataccctcattattttttaatagattttcaaatgacaatgcaat |
116821 |
T |
|
| Q |
197 |
taaatgttgagtggttgttggagttgcctatgatgtcctcagcttgaggaatcttatgactatctaatatccggatttgcttatacttaagcagataatc |
296 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
116822 |
taaatgttgagtggttgttggagttgcctatgatgtcctcagcttgaggaatcttatgactatctaatatccggatttgcttatacttaagcagataatc |
116921 |
T |
|
| Q |
297 |
aaataattggccagccttatgtcaaaggcttataacattctatctt-tgatgaactt |
352 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
116922 |
aaataattggccagccttatgtcaaaggcttataacattcaatcttctgatgaactt |
116978 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University