View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10957_low_31 (Length: 365)
Name: NF10957_low_31
Description: NF10957
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10957_low_31 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 316; Significance: 1e-178; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 316; E-Value: 1e-178
Query Start/End: Original strand, 19 - 346
Target Start/End: Complemental strand, 42444839 - 42444512
Alignment:
| Q |
19 |
catcaggtgtgattcctgaatctagaacaccaataataattccctttccaaaatttgattccttccaaaatccgatattttgctgcaaccccaagaaatc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
42444839 |
catcaggtgtgattcctgaatctagaacaccaataataattccctttccaaaatttgattccttccaagatccgatattttgctgcaaccccaagaaatc |
42444740 |
T |
|
| Q |
119 |
tggggtatgtgtggtttgacgacgtagtgtcctttcgggatgagctgaaacaaaaccattcttctgttcaacagctctcaactcttcttgagttagtctt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
42444739 |
tggggtatgtgtggtttgacgacgtagtgtcctttcgggatgagctgaaacaaaaccattcttctgttgaacagctctcaactcttcttgagttagtctt |
42444640 |
T |
|
| Q |
219 |
gcggcaaaaccactcaacacatttctgtatgaataaatcattcgcggttgttcatcagagctcataaccgtagttggcatgaatgaatgatgccagcttt |
318 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42444639 |
gcggcaaaaccactcaacacatttcggtatgaataaatcattcgcggttgttcatcagagctcataaccgtagttggcatgaatgaatgatgccagcttt |
42444540 |
T |
|
| Q |
319 |
ctaaatcttcttctgattgagtgaatag |
346 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
42444539 |
ctaaatcttcttctgattgagtgaatag |
42444512 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University