View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10957_low_51 (Length: 274)

Name: NF10957_low_51
Description: NF10957
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10957_low_51
NF10957_low_51
[»] chr4 (1 HSPs)
chr4 (1-256)||(46453901-46454156)


Alignment Details
Target: chr4 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 1 - 256
Target Start/End: Complemental strand, 46454156 - 46453901
Alignment:
1 aatagaatattgaagagtatatgatagcctgtgcgaacacgtaagggaactcaatcacaacctgcacaatggaggataacgcattagtgaacttatggaa 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46454156 aatagaatattgaagagtatatgatagcctgtgcgaacacgtaagggaactcaatcacaacctgcacaatggaggataacgcattagtgaacttatggaa 46454057  T
101 aactgtaggttccaggcactttgtaagtaaaaatacctgagctcttgctctatatgaaacaaactgaaaaaatacctgagcaaatgcaaaacataaagcc 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||     
46454056 aactgtaggttccaggcactttgtaagtaaaaatacctgagctcttgctctatatgaaacaaactgaaaaaatacctgagcaaatgcaaaacataaagct 46453957  T
201 gagtacatccctgcagctctttctctatatgaaacaaatctttccactgaaacaac 256  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46453956 gagtacatccctgcagctctttctctatatgaaacaaatctttccactgaaacaac 46453901  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University