View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10957_low_58 (Length: 260)
Name: NF10957_low_58
Description: NF10957
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10957_low_58 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 17 - 252
Target Start/End: Complemental strand, 19125193 - 19124961
Alignment:
| Q |
17 |
aattacccaatgaagagcaaaaagtagcagattcaagaaccaagatcgcaactctaacaaaaacaaacggcaacaagatcccaagcactaacaccaccgg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19125193 |
aattacccaatgaagagcaaaaagtagcagattcaagaaccaagatcgcaactctaacaaaaacaaacggcaacaagatcccaagcactaacaccaccgg |
19125094 |
T |
 |
| Q |
117 |
aagcaccgtccggagagaaatccggcgaccggaagaaccactaacagtcggactccctcctccacccgccgtcgtcgttgtatcctttcccgatccctta |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
19125093 |
aagcaccgtccggagagaaatccggcgaccggaagaaccactaacagtcggactcc---ctccacccaccgtcgtcgttgtatcctttcccgatccctta |
19124997 |
T |
 |
| Q |
217 |
ccgtttgatattgttactcgttttattccctttgct |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
19124996 |
ccgtttgatattgttactcgttttattccctttgct |
19124961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University