View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10957_low_62 (Length: 250)
Name: NF10957_low_62
Description: NF10957
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10957_low_62 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 242
Target Start/End: Original strand, 5135502 - 5135744
Alignment:
| Q |
1 |
acacaagatagtccatattagtactatacttgttcaaatacgtttaattatgaagttttgatgagatccgatctgatacactagtgtatagtttaattgt |
100 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
5135502 |
acacgagatagtccatattagtactatacttgttcaaatacgtttaattatgaagttttgatgagatccgatctgatacattagtgtatagtttaattgt |
5135601 |
T |
|
| Q |
101 |
atatgatatttaagcacactaaataaaaatatgg-ttggtaggattattaatatgaactaaaaatatagttaacctgattctctgcaaggcccatttgaa |
199 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5135602 |
atctgatatttaagcacactaaataaaaatatggtttggtaggattattaatatgaattaaaaatatagttaacctgattctctgcaaggcccatttgaa |
5135701 |
T |
|
| Q |
200 |
taattcccttggggttttgaacttcatcataagggttcttctc |
242 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
5135702 |
taattcccttggggttttgaacttcatcgtaagggttcttctc |
5135744 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 56; Significance: 3e-23; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 107 - 242
Target Start/End: Complemental strand, 38879885 - 38879751
Alignment:
| Q |
107 |
tatttaagcacactaaataaaaatatggttggtaggattattaatatgaactaaaaatatagttaacctgattctctgcaaggcccatttgaataattcc |
206 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||| | ||||| |||| || ||||| |||| |||||| ||| || ||| | ||||||||||||||||| |
|
|
| T |
38879885 |
tatttaagcacattaaatgaaaatatggttggtacggttatttatattaaataaaagtataactaacctaattttcagca-gacccatttgaataattcc |
38879787 |
T |
|
| Q |
207 |
cttggggttttgaacttcatcataagggttcttctc |
242 |
Q |
| |
|
|||| ||||| |||||| |||||||||| ||||||| |
|
|
| T |
38879786 |
cttgaggtttagaactttatcataagggctcttctc |
38879751 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University