View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10957_low_71 (Length: 243)
Name: NF10957_low_71
Description: NF10957
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10957_low_71 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 20 - 233
Target Start/End: Complemental strand, 12682867 - 12682654
Alignment:
| Q |
20 |
tagtttcttgcggcgcttgttgctgctgaggaacaatggtactgttgttcaatacaggaggaacaagaatttgttgttcttgttgttcagcaatcttctg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
12682867 |
tagtttcttgcggcgcttgttgctgctgaggaacaatggtgctgttgttcaatacaggaggaacaagattttgttgttcttgttgttcagcaatcttctg |
12682768 |
T |
|
| Q |
120 |
caaaaaagccataacagcagcatctttggtagcagcaagagatctctcttgagcaagaatttccctttctctattaatcctttgcatctcttgcaacctc |
219 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12682767 |
caaaaaagccataacagcagcatctttagtagcagcaagagatctctcttgagcaagaatttccctttctctattaatcctttgcatctcttgcaacctc |
12682668 |
T |
|
| Q |
220 |
caagcttcttctct |
233 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
12682667 |
caagcttcttctct |
12682654 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 99 - 233
Target Start/End: Original strand, 44553835 - 44553969
Alignment:
| Q |
99 |
ttgttgttcagcaatcttctgcaaaaaagccataacagcagcatctttggtagcagcaagagatctctcttgagcaagaatttccctttctctattaatc |
198 |
Q |
| |
|
||||||||| || || || ||||| |||| ||| || ||||||||||| | |||| | |||||| || || ||||| |||||||| |||||||| || |
|
|
| T |
44553835 |
ttgttgttcggctattttttgcaagaaagacatgactgcagcatcttttgctgcagttatagatctttcgtgtgcaagcatttccctctctctattgatt |
44553934 |
T |
|
| Q |
199 |
ctttgcatctcttgcaacctccaagcttcttctct |
233 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||| |
|
|
| T |
44553935 |
ctttgcatctcttgtgctctccacgcttcttctct |
44553969 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University