View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10957_low_78 (Length: 238)
Name: NF10957_low_78
Description: NF10957
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10957_low_78 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 149; Significance: 8e-79; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 71 - 223
Target Start/End: Original strand, 33728156 - 33728308
Alignment:
| Q |
71 |
gcagctagatgattgggttctatgtcgtatctacaagaaaaattcaagcgcacaaaaacctattccaaacggcgtcatttcaagcagggaatacactcaa |
170 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33728156 |
gcagctagatgattgggttctatgtcgtatctacaagaaaaattcaagtgcacaaaaacctattccaaacggcgtcatttcaagcagggaatacactcaa |
33728255 |
T |
|
| Q |
171 |
tacagcaacggttcatcgtcttcttcatcatcccacctcgacgacgttcttga |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33728256 |
tacagcaacggttcatcgtcttcttcatcatcccacctcgacgacgttcttga |
33728308 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 71 - 127
Target Start/End: Original strand, 20702018 - 20702074
Alignment:
| Q |
71 |
gcagctagatgattgggttctatgtcgtatctacaagaaaaattcaagcgcacaaaa |
127 |
Q |
| |
|
|||||| |||||||||||| | ||||| || ||||||||||| |||||| ||||||| |
|
|
| T |
20702018 |
gcagcttgatgattgggttttgtgtcgaatatacaagaaaaactcaagctcacaaaa |
20702074 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University