View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10957_low_83 (Length: 229)
Name: NF10957_low_83
Description: NF10957
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10957_low_83 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 16 - 211
Target Start/End: Complemental strand, 11758664 - 11758469
Alignment:
| Q |
16 |
gaaacaaaacgtacattgttatgaagagaaaaatcttctacaacaattgaagtagctttaaccggagaacctagcttcgcgaattcgtcgcggtatcgaa |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
11758664 |
gaaacaaaacgtacattgttatgaagagaaaaatcttctacaacaattgaagtagctttaaccggagaacctagctttgcgaattcgtcgcggtatcgaa |
11758565 |
T |
 |
| Q |
116 |
gaagcaacgaataagtatgagaaggagtttcaccaacggatccttgtgaaaactcgctaccagaatcaatgaactgcgacggagaataatctgaac |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11758564 |
gaagcaacgaataagtatgagaaggagtttcaccaacggatccttgtgaaaactcgctaccagaatcaatgaactgcgacggagaataatctgaac |
11758469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University