View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10957_low_86 (Length: 225)

Name: NF10957_low_86
Description: NF10957
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10957_low_86
NF10957_low_86
[»] chr3 (1 HSPs)
chr3 (1-215)||(7125436-7125650)


Alignment Details
Target: chr3 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 1 - 215
Target Start/End: Complemental strand, 7125650 - 7125436
Alignment:
1 ttataagttctgagaagtagtaaannnnnnnaacaaattctggtatttttgtgcgagcaagtgggaataaaacaaattctgaatcgaacttgattcaggc 100  Q
    ||||||||||||||||||||||||       |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7125650 ttataagttctgagaagtagtaaatttttttaacaaattctggtatttttgtgcgagcaagtgggaataaaacaaattctgaatcgaacttgattcaggc 7125551  T
101 tttgttatatgctcgtacgannnnnnnnngttgacaaattacaagtattccgctttcnnnnnnnnntagttacaagtattccggttattgctcatttagg 200  Q
    ||||||||||||||||||||         ||||||||||||||||||||||||||||         ||||||||||||||||||||||||||||||||||    
7125550 tttgttatatgctcgtacgatttttttttgttgacaaattacaagtattccgctttcaaaaaaaaatagttacaagtattccggttattgctcatttagg 7125451  T
201 aattttaatataaaa 215  Q
    |||||||||||||||    
7125450 aattttaatataaaa 7125436  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University