View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10957_low_86 (Length: 225)
Name: NF10957_low_86
Description: NF10957
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10957_low_86 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 1 - 215
Target Start/End: Complemental strand, 7125650 - 7125436
Alignment:
| Q |
1 |
ttataagttctgagaagtagtaaannnnnnnaacaaattctggtatttttgtgcgagcaagtgggaataaaacaaattctgaatcgaacttgattcaggc |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7125650 |
ttataagttctgagaagtagtaaatttttttaacaaattctggtatttttgtgcgagcaagtgggaataaaacaaattctgaatcgaacttgattcaggc |
7125551 |
T |
 |
| Q |
101 |
tttgttatatgctcgtacgannnnnnnnngttgacaaattacaagtattccgctttcnnnnnnnnntagttacaagtattccggttattgctcatttagg |
200 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
7125550 |
tttgttatatgctcgtacgatttttttttgttgacaaattacaagtattccgctttcaaaaaaaaatagttacaagtattccggttattgctcatttagg |
7125451 |
T |
 |
| Q |
201 |
aattttaatataaaa |
215 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
7125450 |
aattttaatataaaa |
7125436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University