View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10957_low_89 (Length: 213)
Name: NF10957_low_89
Description: NF10957
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10957_low_89 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 15 - 196
Target Start/End: Complemental strand, 36028925 - 36028745
Alignment:
| Q |
15 |
atgaataaatacctatctattgtggttgtgtcatgtagtcacttatcttcaacctaaatctcttcttcaactatcatcttgtcacctacgcgcacaaacg |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36028925 |
atgaataaatacctatctattgtggttgtgtcatgtagttacttatcttcaacctaaatctcttcttcaactatcatcttgtcacctacgcgcacaaacg |
36028826 |
T |
|
| Q |
115 |
tgcagaaaaaatcacctcatcatactgtatagtctttttacattaaagaatgaacataaagaaataaataagtgaaaccatg |
196 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
36028825 |
tgcaga-aaaattacctcatcatactgtatagtctttttacattaaagaatgaacataaaaaaataaataagtgaaaccatg |
36028745 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University