View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10958_high_8 (Length: 242)
Name: NF10958_high_8
Description: NF10958
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10958_high_8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 38546159 - 38545940
Alignment:
| Q |
1 |
tttattaacaatctttctgatttagcagttactgtctctaaacttatcttgttgagtatgccaatctttgatttctccaaaacaagaaactattggaaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
38546159 |
tttattaacaatctttctgatttagcagttactgtctctaaacttatcttgttgagtatgccaatctttgatttcttcaaaacaaaaaactattggaaaa |
38546060 |
T |
|
| Q |
101 |
ctttgattcaaagtccaatcctgaaatcaaatcacttagttataaatggctataactttgataggtttacaatgctttgtttgtaacttgaatcagttgg |
200 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38546059 |
ctttgattcaaagtccaatccttaaatcaaatcacttagttataaatggctataactttgataggtttacaatgctttgtttgtaacttgaatcagttgg |
38545960 |
T |
|
| Q |
201 |
cctccactcactatctgcaa |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
38545959 |
cctccactcactatctgcaa |
38545940 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University