View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10959_high_19 (Length: 315)
Name: NF10959_high_19
Description: NF10959
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10959_high_19 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 1 - 286
Target Start/End: Original strand, 43186025 - 43186312
Alignment:
| Q |
1 |
aagagcacaagcctggcacttgttgcnnnnnnnctctaacctctggaaaacctacatcgcagagcggaaaatggttgctaactcaacatttcttcagatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||| |
|
|
| T |
43186025 |
aagagcacaagcctggcacttgttgcaaaaaacctctaacctctggaaaacctacatcgcagagtggaaaatggttgctaagtcaacatttcttcagatg |
43186124 |
T |
 |
| Q |
101 |
ttatgaagctaaaacaaccactaacatcttagcaattggttttttcaattggtaaatccaacttaagccaaaatgaatggtttaaaaataaccactgttg |
200 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43186125 |
ttatgaagctgaaacaaccactaacatcttagcaattggttttttcaattggtaaatccaacttaagccaaaatgaatggtttaaaaataaccactgttg |
43186224 |
T |
 |
| Q |
201 |
tcgattgcagatcgcggagaagagtggtttgcttgaaattggctatgctacgagcta--tacagctgctatttaacaacaatgatgat |
286 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
43186225 |
tcgattgcagatcgcggagaagagtggtttgcttgaaattggctatgctacgagctatgtacagctgctatttaacaacaatgatgat |
43186312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University