View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10959_high_38 (Length: 201)

Name: NF10959_high_38
Description: NF10959
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10959_high_38
NF10959_high_38
[»] chr3 (1 HSPs)
chr3 (1-188)||(54880801-54880988)


Alignment Details
Target: chr3 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 188
Target Start/End: Complemental strand, 54880988 - 54880801
Alignment:
1 tgacagatatcacaaagagggtagtctttggagttgaggtgaacaagagaaaaacgagtgtgtttggttgcgagcttgttggcacggtggatggtatgat 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
54880988 tgacagatatcacaaagagggtagtctttggagttgaggtgaacaagagaaaaacgagtgtgtttggttgcgagcttgttggcacggtggatggtatgat 54880889  T
101 cacatccatggcaaagagcagcttcatctgaaggacagaacatagtagcctcagctttctcacacacatcacattggatcttcatctc 188  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
54880888 cacatccatggcaaagagcagcttcatctgaaggacagaacatagtagcctcagctttctcacacacatcacattggatcttcatctc 54880801  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University