View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10959_high_8 (Length: 416)
Name: NF10959_high_8
Description: NF10959
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10959_high_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 320; Significance: 1e-180; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 320; E-Value: 1e-180
Query Start/End: Original strand, 9 - 402
Target Start/End: Original strand, 5529142 - 5529539
Alignment:
| Q |
9 |
gagaagcagagaaagggaaaaaggaaaagttagggggtggtgggggcatagagagtgctactactgattcaaaagccataagttnnnnnnnnnnnnnnnn |
108 |
Q |
| |
|
||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5529142 |
gagaaacaaagaaagggaaaaaggaaaagttagggggtggtgggggcatagagagtgctactactgattcaaaagccataagttgagagagagagagaga |
5529241 |
T |
 |
| Q |
109 |
--aagtgggaacattctgaaattggttggctttttgtgtttgtgtagctagctgtggtggctgtcatcaaaagatgaggaacagctcatcttttttcaag |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5529242 |
gaaagtgggaacattctgaaattggttggctttttgtgtttgtgtagctagctgtggtggctgtcatcaaaagatgaggaacagctcatcttttttcaag |
5529341 |
T |
 |
| Q |
207 |
cctcatcttttgccattcttttgattggttcatgtagtttcatccttgtttatgtttatgtttatagacataaacacctcttcttttttcatatactaaa |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5529342 |
cctcatcttttgccattcttttgattggttcatgtagtttcatccttgtttatgtttatgtttatagacataaacacctcttcttttttcatatactaaa |
5529441 |
T |
 |
| Q |
307 |
ccaaacaaacctt--tgtttctttgatatcaactataaaccagaaacaatttctgtgtcttctaggtatgtcttcaaactattcatatcatgtttttg |
402 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5529442 |
ccaaacaaacctttgtgtttctttgatatcaactataaaccagaaacaatttctgtgtcttctaggtatgtcttcaaactattcatatcatgtttttg |
5529539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University