View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10959_low_41 (Length: 201)
Name: NF10959_low_41
Description: NF10959
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10959_low_41 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 188
Target Start/End: Complemental strand, 54880988 - 54880801
Alignment:
| Q |
1 |
tgacagatatcacaaagagggtagtctttggagttgaggtgaacaagagaaaaacgagtgtgtttggttgcgagcttgttggcacggtggatggtatgat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54880988 |
tgacagatatcacaaagagggtagtctttggagttgaggtgaacaagagaaaaacgagtgtgtttggttgcgagcttgttggcacggtggatggtatgat |
54880889 |
T |
 |
| Q |
101 |
cacatccatggcaaagagcagcttcatctgaaggacagaacatagtagcctcagctttctcacacacatcacattggatcttcatctc |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54880888 |
cacatccatggcaaagagcagcttcatctgaaggacagaacatagtagcctcagctttctcacacacatcacattggatcttcatctc |
54880801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University