View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10960_high_18 (Length: 217)
Name: NF10960_high_18
Description: NF10960
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10960_high_18 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 213
Target Start/End: Original strand, 46991416 - 46991628
Alignment:
| Q |
1 |
cagattacaatgttctgatttacgaatgagaattccttttgagaaccttccttcttgtgacaggtgctcaagcaattgatctattttacgatgaatgttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46991416 |
cagattacaatgttctgatttacgaatgagaattccttttgagaaccttccttcttgtgacaggtgctcaagcaattgatctattttacgatgaatgttc |
46991515 |
T |
|
| Q |
101 |
actaatgggctcccttctgttttatagggaaatcaaatgaagtggatactgataatttctataatgtgttcatcgatgcagattgatggcaatatgtgaa |
200 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46991516 |
actaatgggctcccttctgttttattgggaaatcaaatgaagtggatactgataatttctataatgtgttcatcgatgcagattgatggcaatatgtgaa |
46991615 |
T |
|
| Q |
201 |
gatatatatgctg |
213 |
Q |
| |
|
||||||||||||| |
|
|
| T |
46991616 |
gatatatatgctg |
46991628 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University