View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10960_low_12 (Length: 274)
Name: NF10960_low_12
Description: NF10960
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10960_low_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 31 - 270
Target Start/End: Original strand, 7424150 - 7424378
Alignment:
| Q |
31 |
aattgattataccgtccaattctatgcttaagtagattttaattcaaccattaacaatagtac--taatactgtttcctattatgattccaaaagtattt |
128 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
7424150 |
aattgattataccgtccaattctatgcttaagtagattttaattcaaccattaacaatagtacactaatactgtttcctattatgattccaaaagta--- |
7424246 |
T |
|
| Q |
129 |
gttattagtatttgttattaggggcccgataaaacaaatcatctctctttcaccaactataagactactatattatcccatccaatattaaaaaactact |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7424247 |
----------tttgttattaggggcccgataaaacaaatcatctctctttcaccaactataagactactatattatcccatccaatattaaaaaactact |
7424336 |
T |
|
| Q |
229 |
acaccatgcattattattatttgaccgccccctatgcttctc |
270 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
7424337 |
acaccatgcattattattatttgaccgccccttatgcatctc |
7424378 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University