View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10961_high_7 (Length: 325)
Name: NF10961_high_7
Description: NF10961
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10961_high_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 288; Significance: 1e-161; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 288; E-Value: 1e-161
Query Start/End: Original strand, 1 - 313
Target Start/End: Complemental strand, 45671834 - 45671518
Alignment:
| Q |
1 |
tgtcatggctgccagtgctgttgaacttcttactgacttggtcaaggctttacaggcagtcaatgctactgcatggcacaatgcttttttaggtttatgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45671834 |
tgtcatggctgccagtgctgttgaacttcttactgacttggtcaaggctttacaggcagtcaatgctactgcatggcacaatgcttttttaggtttatgg |
45671735 |
T |
 |
| Q |
101 |
tttgctgccctgcgactcgttcaaagggtaagaaatactaactt----cagccaattgattaactcaaatatgttctggttgctcatttatgtgccagac |
196 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
45671734 |
tttgctgccctgcggctcgttcaacgggtaagaaatactaacttgtttcagccaattgattaactcaaatctgttctggttgctcatttatgtgccagac |
45671635 |
T |
 |
| Q |
197 |
actgcattgtccacgagcttacaaatgtgtaacatgtggtcaaatgcagattttttagccataaaaattaaagaaaatatagcatgtcaatttaccttct |
296 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45671634 |
actgcattgtccacgagcttacaaatgtgtaacatgtggtcaaatgcagattttttagccataaaaattaaagaaaatatagcatgtcaatttaccttct |
45671535 |
T |
 |
| Q |
297 |
ttgtaagcttgcatatt |
313 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
45671534 |
ttgtaagcttgcatatt |
45671518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University