View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10962_high_10 (Length: 237)
Name: NF10962_high_10
Description: NF10962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10962_high_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 13 - 222
Target Start/End: Original strand, 3532175 - 3532378
Alignment:
| Q |
13 |
cagaagaaaagtgaaataatgtgattgatgcaggagctatttttggggagattctctacnnnnnnnncgtaaaaattatattcttactttgtctttattt |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | | ||||||||||||||||||||||||||||| |
|
|
| T |
3532175 |
cagaagaaaagtgaaataatgtgattgatgcaggagctatttttggggagattctctacttttttttcatcaaaattatattcttactttgtctttattt |
3532274 |
T |
 |
| Q |
113 |
gatccatatctgtcaaatcttaattactcttcaaagagagtctttttgagttgctttagagagtttaagggatgcaattgtgacaatatataccactatc |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
3532275 |
gatccatatctgtcaaatcttaattactcttcaa--agagtctttttgagttgctttagagagtttaagggatgcaattgtgaca----ataccactatc |
3532368 |
T |
 |
| Q |
213 |
ctttaattgt |
222 |
Q |
| |
|
|| ||||||| |
|
|
| T |
3532369 |
ctataattgt |
3532378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University