View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10964_high_1 (Length: 545)
Name: NF10964_high_1
Description: NF10964
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10964_high_1 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 257; Significance: 1e-143; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 254 - 518
Target Start/End: Original strand, 49758174 - 49758438
Alignment:
| Q |
254 |
cttgacttgttttgaatcaaattagatatatatatcagatgagatttatatacgtctggcagcaaaataagcagcactcgccggtcaagggaagaagatg |
353 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49758174 |
cttgacttgttttggatcaaattagatatatatatcagatgagatttatatacgtctggcagcaaaataagcagcactcgccggtcaagggaagaagatg |
49758273 |
T |
 |
| Q |
354 |
caattttttgtaatatttgtagtataacgtcatatttaccaacttattattgtgaaatgcagttctatttttattgggtaaacacttattgagattgtct |
453 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
49758274 |
caattttttgtaatatttgtagtataacgtcatatttaccaacttattattgtgaaatgcagttctatttttattgggtaaacactttttgagattgtct |
49758373 |
T |
 |
| Q |
454 |
aaacctcaattgtcttggccattaattcagaatagataatttcgttgattcatttactttacccc |
518 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49758374 |
aaacctcaattgtcttggccattaattcagaatagataatttcgttgattcatttactttacccc |
49758438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 179; E-Value: 2e-96
Query Start/End: Original strand, 12 - 190
Target Start/End: Original strand, 49757932 - 49758110
Alignment:
| Q |
12 |
cacagaggatgatccacataagagaaagccagacatctccaaagcaaaagagcttcttggctggcaaccatctgtgtccctccgtgagggacttcctcta |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49757932 |
cacagaggatgatccacataagagaaagccagacatctccaaagcaaaagagcttcttggctggcaaccatctgtgtccctccgtgagggacttcctcta |
49758031 |
T |
 |
| Q |
112 |
atggtcgctgatttcaagcaaagattatttggtgatggggacaaaggtgcagctgcagcataggtcagtacagctgtgg |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49758032 |
atggtcgctgatttcaagcaaagattatttggtgatggggacaaaggtgcagctgcagcataggtcagtacagctgtgg |
49758110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University