View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10964_low_4 (Length: 315)
Name: NF10964_low_4
Description: NF10964
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10964_low_4 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 22 - 301
Target Start/End: Original strand, 4067542 - 4067821
Alignment:
| Q |
22 |
gacgcatcttgttttcttctttttgtccatgaaaaatcattagacactcctttgacatttactggtacactatagccattaccatcagcaacattcaact |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4067542 |
gacgcatcttgttttcttctttttgtccatgaaaaatcattagacacccctttgacatttactggtacactatagccattaccatcagcaacattcaact |
4067641 |
T |
 |
| Q |
122 |
tttgagaagtctctaacattgcattcattgaagtctttgagtgatctttgtgcatagtatctccttttccctttggaagatttgctttaccatcatcttt |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4067642 |
tttgagaagtctctaacattgcattcattgaagtctttgagtgatctttgtgcatagtatctccttttccctttggaagatttgctttaccatcatcttt |
4067741 |
T |
 |
| Q |
222 |
tctagcattttgagaaatattctgcgtttcgatcgcnnnnnnnttaagatgagcaaatataagtaatagtactctctctg |
301 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || |||||||||| |||||||||||||||||||||||||| |
|
|
| T |
4067742 |
tctagcattttgagaaatattctgcgtttcgatggcaaaaaaattaagatgagtaaatataagtaatagtactctctctg |
4067821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University