View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10965_high_19 (Length: 273)
Name: NF10965_high_19
Description: NF10965
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10965_high_19 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 241; Significance: 1e-133; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 1 - 264
Target Start/End: Original strand, 698386 - 698650
Alignment:
| Q |
1 |
ctgttttttgttttcctatgcttttgatcattgagcttagagctttggatagtgtgctttcttgtggagtttttggtggccggcgattaatgactgactt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||| |
|
|
| T |
698386 |
ctgttttttgttttcctatgcttttgatcattgagcttagagctttggatagtgtgctttcttgtggagtttttggtggccggcaatcaatgactgactt |
698485 |
T |
|
| Q |
101 |
cagaggaa-tattataggctttggttttctttcctttttatgaactaataggctttggttactgccatgggttaactgatgttgtgtatatatcttttcc |
199 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
698486 |
cagaggaaatattataggctttggttttctttcctttttatgaactaataggctttggttactgccatgggttaactgatgttgtgtatatatcttttcc |
698585 |
T |
|
| Q |
200 |
agtgtgtgacagggtcaattttaatgctgatgaatatattatatatctttaatccacaggttctg |
264 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
698586 |
agtgtgtgacagggtcatttttaatgctgatgaatatattatatatctttaatccacagtttctg |
698650 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 6 - 60
Target Start/End: Original strand, 665591 - 665644
Alignment:
| Q |
6 |
ttttgttttcctatgcttttgatcattgagcttagagctttggatagtgtgcttt |
60 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
665591 |
ttttgttttc-tatgcttttgttcattgagcttagagctttggatagtgtgcttt |
665644 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University