View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10965_high_27 (Length: 239)
Name: NF10965_high_27
Description: NF10965
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10965_high_27 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 95; Significance: 1e-46; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 16 - 153
Target Start/End: Complemental strand, 39930816 - 39930681
Alignment:
| Q |
16 |
cacatattattaccaatgaaattaattgagatatcaagtttatttcttgtnnnnnnnnnntatttcgtattaaattatgatttctaggatgataattatg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
39930816 |
cacatattattaccaatgaaattaattgagatatcaagtttatttcttgtaaaaaaaa--tatttcgtattaaattatgatttccaggatgataattatg |
39930719 |
T |
 |
| Q |
116 |
ttatattgatgtatatcatagaagtatatttgattctc |
153 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
39930718 |
ttatattgatgtatatcatagaagtatatttcattctc |
39930681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 172 - 222
Target Start/End: Complemental strand, 39930616 - 39930565
Alignment:
| Q |
172 |
tttcgaccttgaaaggcctccg-gatccaattcgtctcactttattatatat |
222 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
39930616 |
tttcgaccttgaaaggcctccgtgatccaattcgtctcactttattatatat |
39930565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University