View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10965_high_32 (Length: 206)
Name: NF10965_high_32
Description: NF10965
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10965_high_32 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 119; Significance: 5e-61; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 119; E-Value: 5e-61
Query Start/End: Original strand, 10 - 191
Target Start/End: Original strand, 46853289 - 46853480
Alignment:
| Q |
10 |
aggagcacagaacaaggcattgtgtgacatggctttgcataagacaaaattattgtgtgacatatggnnnnnnn--cctataatataagaccatgattag |
107 |
Q |
| |
|
|||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
46853289 |
aggaacacaaaacaaggcattgtgtgacatggctttgcataagacaaaattattgtgtgacatatggtttttttttcctataatataagaccatgattag |
46853388 |
T |
 |
| Q |
108 |
agcaaact--------ccaagagttaatgtgatacatagacttctcgggtaaaaggatagggaaaactacactgaattggataagagaaatt |
191 |
Q |
| |
|
||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46853389 |
agctaactcttgaactccaagagttaatgtgatacatagacttctcgggtaaaaggatagggaaaactacactgaattggataagagaaatt |
46853480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University