View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10965_high_33 (Length: 201)
Name: NF10965_high_33
Description: NF10965
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10965_high_33 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 13 - 185
Target Start/End: Complemental strand, 23496434 - 23496268
Alignment:
| Q |
13 |
gagatgaacactcctgctgttcccgtggtggaggaggaacaaccttgtggtgatgacagagtcgtccctctggagattgcgaatgcccttgccgcaaagg |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
23496434 |
gagatgaacactcctgctgttcccgtggtggaggaggaacaaccttgtggtgatgacagagtcgtccctccggagattgc------ccttgccgcaaagg |
23496341 |
T |
 |
| Q |
113 |
cggctgattctgcaaagggttagagtctgtcccggttgttatgggatagggcgactctaaaaattgtacattc |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
23496340 |
cggctgattctgcaaagggttagagtctgtcccggttgttatgggagagggcgactctaaaaattgtacattc |
23496268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University