View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10965_low_18 (Length: 321)
Name: NF10965_low_18
Description: NF10965
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10965_low_18 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 99; Significance: 7e-49; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 99; E-Value: 7e-49
Query Start/End: Original strand, 169 - 282
Target Start/End: Original strand, 4847497 - 4847611
Alignment:
| Q |
169 |
attcttgaaatctcttgttatatggag-acaccttccgaagagcttcaaagactcatttgtttatatttttggagcctacattcttaaaaatgtgtgttt |
267 |
Q |
| |
|
||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
4847497 |
attcttgaaatctctggttatatggaggacaccttccgaagagcttcaaagactcatttgtttatagttttggagcctacattcttaaaaatgtgtgttt |
4847596 |
T |
|
| Q |
268 |
agcctcttagtgttt |
282 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
4847597 |
agcctcttagtgttt |
4847611 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 18 - 82
Target Start/End: Original strand, 4847068 - 4847132
Alignment:
| Q |
18 |
aaatctcatttccacaaaccctatgtaagtattccagccatttgcttaggaactttagttttata |
82 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4847068 |
aaatctcatttccacaaaccctatgtaagtattccagccatttgcttaggaactttagttttata |
4847132 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 106 - 171
Target Start/End: Original strand, 4847402 - 4847469
Alignment:
| Q |
106 |
agttattcacacttggtgtgaaggcg--tgtgttgattggctagcaaattttaacctctcttcagatt |
171 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4847402 |
agttattcacacttggtgtgaaggcagatgtgttgattggctagcaaattttaacctctcttcagatt |
4847469 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University