View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10965_low_21 (Length: 269)
Name: NF10965_low_21
Description: NF10965
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10965_low_21 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 1 - 248
Target Start/End: Complemental strand, 698392 - 698145
Alignment:
| Q |
1 |
aaaacagatcagtcagataagtttaccaaggttccaatctctggtttaggttccaataactcggccataggctcaattttatccataagttttttatatt |
100 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
698392 |
aaaacagatcagtcagctaagtttaccaaggtcccaatctctggtttaggttccaataactcggccataggctcaattttatccataagttttttatatt |
698293 |
T |
|
| Q |
101 |
tcttctcttttctctcaaatttatgtagacacttctgatgataatttgttgctttatcaattttttcttcaatcagcagcaactcttcttcaatctgagt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
698292 |
tcttctcttttctctcaaatttatgtagacacttctgatgataatttgttgctttatcaattttttcttcaatcagcagcaactcttcttcaatctgagt |
698193 |
T |
|
| Q |
201 |
taagattcccatagcttccggagaaatgtccaacttgttcgtacaagg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
698192 |
taagattcccatagcttccggagaaatgtccaacttgttcgtacaagg |
698145 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University