View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10965_low_22 (Length: 262)
Name: NF10965_low_22
Description: NF10965
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10965_low_22 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 36 - 246
Target Start/End: Complemental strand, 39930180 - 39929973
Alignment:
| Q |
36 |
atggttttcttttctctaataaaatgaaccgtgatttatgtttgtaacaaaaggagagtttgatatttattttggtagatacgaatttcttgttttacgg |
135 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39930180 |
atggttttcttttctcttataaaatgaaccgtgatttatgtttgtaacaaaaggagagtttgatatttattttggtagatacgaatttcttgttttacgg |
39930081 |
T |
 |
| Q |
136 |
ataaagtcattaatggaattgtaatcggttaatcacttttttgtattttggttagctaaaggttaatcacttatttgagctgtatatgtatatatttttc |
235 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
39930080 |
ataaagtcattaatgggattgtaatcggttaatcacttttttat-ttttggttagctaaaggttaatcacttatttgagctg--tatgtatatatttttc |
39929984 |
T |
 |
| Q |
236 |
agtatttcttc |
246 |
Q |
| |
|
||||||||||| |
|
|
| T |
39929983 |
agtatttcttc |
39929973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University