View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10965_low_32 (Length: 214)
Name: NF10965_low_32
Description: NF10965
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10965_low_32 |
 | |
|
| [»] scaffold0014 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0014 (Bit Score: 112; Significance: 8e-57; HSPs: 1)
Name: scaffold0014
Description:
Target: scaffold0014; HSP #1
Raw Score: 112; E-Value: 8e-57
Query Start/End: Original strand, 14 - 200
Target Start/End: Complemental strand, 89528 - 89347
Alignment:
| Q |
14 |
atgaaaggggaggagtggctcgaaaatgtataaagtagaaagaaggtgaagagaattcttaataagtcaatagaactctttaaccgaatnnnnnnnnnnn |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
89528 |
atgaaaggggaggagtggctcgaaaatgtatcaagtagaaagaaggtgaagagaattcttgataactcaatagaactctttaaccgaat-----aaaaaa |
89434 |
T |
|
| Q |
114 |
nnntattcacttgagagttatggttgtagttcacaaaaacctccaagggatcaaacaattgagagaagctctttgaaatatataaac |
200 |
Q |
| |
|
|| |||||||| ||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
89433 |
aaataatcacttgacagttatggttgtagttcacaataacctccaagtgatcaaacaattgagagaagctctttgaaatatataaac |
89347 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University