View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10965_low_34 (Length: 201)

Name: NF10965_low_34
Description: NF10965
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10965_low_34
NF10965_low_34
[»] chr8 (1 HSPs)
chr8 (13-185)||(23496268-23496434)


Alignment Details
Target: chr8 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 13 - 185
Target Start/End: Complemental strand, 23496434 - 23496268
Alignment:
13 gagatgaacactcctgctgttcccgtggtggaggaggaacaaccttgtggtgatgacagagtcgtccctctggagattgcgaatgcccttgccgcaaagg 112  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||      ||||||||||||||    
23496434 gagatgaacactcctgctgttcccgtggtggaggaggaacaaccttgtggtgatgacagagtcgtccctccggagattgc------ccttgccgcaaagg 23496341  T
113 cggctgattctgcaaagggttagagtctgtcccggttgttatgggatagggcgactctaaaaattgtacattc 185  Q
    |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
23496340 cggctgattctgcaaagggttagagtctgtcccggttgttatgggagagggcgactctaaaaattgtacattc 23496268  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University